keyword in microRNA or target gene :
The pre-miRNA of MI0000086
Gene
EMBL AJ421750
HGNC MIRN28
Accession no
MI0000086
ID
hsa-mir-28
Species
Homo sapiens
Description
Homo sapiens miR-28 stem-loop
Genomic Location
3 : 189889263 - 189889348 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000312675 intron + 4
OTTHUMT00000267501 intron + 6
OTTHUMT00000267504 intron + 6
OTTHUMT00000267506 intron + 1
View the flanking features in the Genome Browser
Pre-miRNA length
86 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-28 mmu-mir-151 rno-mir-151 mmu-mir-28 hsa-mir-151
rno-mir-28 ssc-mir-28 age-mir-28 mml-mir-28 ptr-mir-28
ggo-mir-28 ppy-mir-28 mne-mir-28 sla-mir-28 lla-mir-28
ppa-mir-28 bta-mir-151
The mature miRNA of MI0000086
Mature name
hsa-miR-28
Mature sequence
14| 5'- AAGGAGCUCACAGUCUAUUGAG -3' |35
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000355249 (targeted by hsa-miR-28, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000356315 (targeted by hsa-miR-28, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
ENST00000011700 (targeted by hsa-miR-28, predicted by TargetScan)
Vacuolar protein sorting-associated protein 13D. [Source:Uniprot/SWISSPROT;Acc:Q5THJ4]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 219316 0937119471