keyword in microRNA or target gene :
The pre-miRNA of MI0000085
Gene
EMBL AF480561
EMBL AJ421749
HGNC MIRN27A
Accession no
MI0000085
ID
hsa-mir-27a
Species
Homo sapiens
Description
Homo sapiens miR-27a stem-loop
Genomic Location
19 : 13808254 - 13808331 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
78 nt
Comments
This miRNA was previously named miR-27 [1,2] but is renamed here to avoid confusion with the more recently described miR-27b (MIR:MI0000440).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-27a mmu-mir-27b hsa-mir-27b mmu-mir-27a rno-mir-27b
rno-mir-27a gga-mir-27b dre-mir-27a dre-mir-27b dre-mir-27c
dre-mir-27d dre-mir-27e ssc-mir-27a ggo-mir-27a age-mir-27a
ppa-mir-27a lca-mir-27a ppy-mir-27a ptr-mir-27a mml-mir-27a
sla-mir-27a mne-mir-27a fru-mir-27b tni-mir-27b fru-mir-27e
tni-mir-27e fru-mir-27c tni-mir-27c bta-mir-27a bta-mir-27b
xtr-mir-27a xtr-mir-27b xtr-mir-27c-1 xtr-mir-27c-2 mdo-mir-27a
mdo-mir-27b
The mature miRNA of MI0000085
Mature name
hsa-miR-27a
Mature sequence
51| 5'- UUCACAGUGGCUAAGUUCCGC -3' |71
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378756 (targeted by hsa-miR-27a, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000378755 (targeted by hsa-miR-27a, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000339113 (targeted by hsa-miR-27a, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
3. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 494333 0937119471