keyword in microRNA or target gene :
The pre-miRNA of MI0000082
Gene
EMBL AJ421746
HGNC MIRN25
Accession no
MI0000082
ID
hsa-mir-25
Species
Homo sapiens
Description
Homo sapiens miR-25 stem-loop
Genomic Location
7 : 99529119 - 99529202 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000362082 intron + 13
ENST00000303887 intron + 13
ENST00000343023 intron + 8
OTTHUMT00000137824 intron + 8
OTTHUMT00000137825 intron + 13
OTTHUMT00000059629 intron + 13
View the flanking features in the Genome Browser
Pre-miRNA length
84 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-25 hsa-mir-92-1 hsa-mir-92-2 dme-mir-92a dme-mir-92b
mmu-mir-92-2 mmu-mir-25 mmu-mir-92-1 rno-mir-25 rno-mir-92-1
rno-mir-92-2 gga-mir-92 dps-mir-92a dps-mir-92b aga-mir-92a
aga-mir-92b dre-mir-25 dre-mir-92a-1 dre-mir-92a-2 dre-mir-92b
ggo-mir-92-1 lca-mir-92-1 age-mir-92-1 ppa-mir-92-1 ppy-mir-92-1
ptr-mir-92-1 mml-mir-92 sla-mir-92-1 lla-mir-92-1 ggo-mir-25
ppa-mir-25 ppy-mir-25 ptr-mir-25 mml-mir-25 lla-mir-25
mne-mir-25 ggo-mir-92-2 age-mir-92-2 ppa-mir-92-2 lca-mir-92-2
ppy-mir-92-2 ptr-mir-92-2 sla-mir-92-2 lla-mir-92-2 mne-mir-92
fru-mir-25 tni-mir-25 fru-mir-92-2 tni-mir-92-2 fru-mir-92-1
tni-mir-92-1 hsa-mir-92b xtr-mir-92a-2 xtr-mir-92b xtr-mir-25-1
xtr-mir-25-2 xtr-mir-92a-1 bta-mir-92 bta-mir-25 mdo-mir-92
mdo-mir-25 ame-mir-92a
The mature miRNA of MI0000082
Mature name
hsa-miR-25
Mature sequence
52| 5'- CAUUGCACUUGUCUCGGUCUGA -3' |73
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

Target genes
ENST00000353409 (targeted by hsa-miR-25, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000377081 (targeted by hsa-miR-25, predicted by TargetScan)
Kinesin-like protein KIF1B (Klp). [Source:Uniprot/SWISSPROT;Acc:O60333]
 
     
ENST00000375753 (targeted by hsa-miR-25, predicted by TargetScan)
Msx2-interacting protein (SPEN homolog) (SMART/HDAC1-associated repressor protein). [Source:Uniprot/SWISSPROT;Acc:Q96T58]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 635829 0937119471