keyword in microRNA or target gene :
The pre-miRNA of MI0000081
Gene
EMBL AF480559
EMBL AJ421745
HGNC MIRN24-2
Accession no
MI0000081
ID
hsa-mir-24-2
Species
Homo sapiens
Description
Homo sapiens miR-24-2 stem-loop
Genomic Location
19 : 13808101 - 13808173 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
73 nt
Comments
mir-24-2 was identified independently by two groups. This sequence was named miR-24 precursor-19 in reference [2].
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-24-1 hsa-mir-24-2 mmu-mir-24-1 mmu-mir-24-2 rno-mir-24-1
rno-mir-24-2 gga-mir-24 dre-mir-24-4 dre-mir-24-2 dre-mir-24-3
dre-mir-24-1 ssc-mir-24 mml-mir-24-1 ppy-mir-24-1 mne-mir-24-1
ppa-mir-24-1 ggo-mir-24 ppa-mir-24-2 ppy-mir-24-2 ptr-mir-24
mml-mir-24-2 mne-mir-24-2 fru-mir-24-1 tni-mir-24-1 fru-mir-24-2
tni-mir-24-2 xtr-mir-24a xtr-mir-24b bta-mir-24 mdo-mir-24-2
mdo-mir-24-1
The mature miRNA of MI0000081
Mature name
hsa-miR-24
Mature sequence
50| 5'- UGGCUCAGUUCAGCAGGAACAG -3' |71
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378756 (targeted by hsa-miR-24, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000378755 (targeted by hsa-miR-24, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000339113 (targeted by hsa-miR-24, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
3. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
4. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
5. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 111206 0937119471