keyword in microRNA or target gene :
The pre-miRNA of MI0000078
Gene
EMBL AF480525
EMBL AJ421742
HGNC MIRN22
Accession no
MI0000078
ID
hsa-mir-22
Species
Homo sapiens
Description
Homo sapiens miR-22 stem-loop
Genomic Location
17 : 1563947 - 1564031 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000334146 3UTR + 3
OTTHUMT00000285485 3UTR + 2
OTTHUMT00000285484 3UTR + 2
OTTHUMT00000285482 3UTR + 2
OTTHUMT00000285481 3UTR + 3
OTTHUMT00000285483 3UTR + 3
OTTHUMT00000285486 3UTR + 3
OTTHUMT00000255250 exon + 3
View the flanking features in the Genome Browser
Pre-miRNA length
85 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-22 mmu-mir-22 rno-mir-22 dre-mir-22a-1 dre-mir-22a-2
dre-mir-22b age-mir-22 ppa-mir-22 lca-mir-22 mml-mir-22
ppy-mir-22 ptr-mir-22 sla-mir-22 lla-mir-22 mne-mir-22
fru-mir-22b tni-mir-22b fru-mir-22a tni-mir-22a xtr-mir-22
bta-mir-22 mdo-mir-22
The mature miRNA of MI0000078
Mature name
hsa-miR-22
Mature sequence
53| 5'- AAGCUGCCAGUUGAAGAACUGU -3' |74
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-22, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-22, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-22, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
3. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 133947 0937119471