keyword in microRNA or target gene :
The pre-miRNA of MI0000074
Gene
EMBL AF480555
EMBL AJ421739
EMBL AF480523
HGNC MIRN19B1
EMBL AB176708
Accession no
MI0000074
ID
hsa-mir-19b-1
Species
Homo sapiens
Description
Homo sapiens miR-19b-1 stem-loop
Genomic Location
13 : 90801447 - 90801533 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000356529 3UTR + 2
ENST00000360600 intron + 3
ENST00000377076 intron + 2
OTTHUMT00000045448 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
87 nt
Comments
Human miR-19b was identified by two independent groups [1,2]. Two predicted hairpin precursors were identified: mir-19b-1 (MIR:MI0000074) on chromosome 13, and mir-19b-2 (MIR:MI0000075) on chromsome X.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-19a hsa-mir-19b-1 hsa-mir-19b-2 mmu-mir-19b-2 mmu-mir-19a
mmu-mir-19b-1 rno-mir-19b-1 rno-mir-19b-2 rno-mir-19a gga-mir-19b
gga-mir-19a xla-mir-19b dre-mir-19a dre-mir-19b dre-mir-19c
dre-mir-19d ssc-mir-19a ggo-mir-19a ggo-mir-19b-1 lca-mir-19a
lca-mir-19b-1 age-mir-19a age-mir-19b-1 ppa-mir-19a ppa-mir-19b-1
ppy-mir-19a ppy-mir-19b-1 ptr-mir-19a ptr-mir-19b-1 mml-mir-19a
mml-mir-19b-1 sla-mir-19a sla-mir-19b-1 lla-mir-19a lla-mir-19b-1
mne-mir-19a mne-mir-19b-1 ggo-mir-19b-2 age-mir-19b-2 ppa-mir-19b-2
lca-mir-19b-2 mml-mir-19b-2 ppy-mir-19b-2 ptr-mir-19b-2 sla-mir-19b-2
lla-mir-19b-2 mne-mir-19b-2 fru-mir-19a tni-mir-19a fru-mir-19b
tni-mir-19b xtr-mir-19a xtr-mir-19b-2 xtr-mir-19b-1 mdo-mir-19a
mdo-mir-19b bta-mir-19a bta-mir-19b
The mature miRNA of MI0000074
Mature name
hsa-miR-19b
Mature sequence
54| 5'- UGUGCAAAUCCAUGCAAAACUGA -3' |76
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000378756 (targeted by hsa-miR-19b, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000378755 (targeted by hsa-miR-19b, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
ENST00000339113 (targeted by hsa-miR-19b, predicted by TargetScan)
ATPase family AAA domain-containing protein 3A. [Source:Uniprot/SWISSPROT;Acc:Q9NVI7]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
3. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
4. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
5. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
6. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
7. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 183171 0937119471