keyword in microRNA or target gene :
The pre-miRNA of MI0000071
Gene
EMBL AJ421735
EMBL AF480562
EMBL AF480529
RFAM mir-17
HGNC MIRN17
EMBL AB176708
Accession no
MI0000071
ID
hsa-mir-17
Species
Homo sapiens
Description
Homo sapiens miR-17 stem-loop
Genomic Location
13 : 90800860 - 90800943 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
ENST00000356529 3UTR + 2
ENST00000360600 intron + 3
ENST00000377076 intron + 2
OTTHUMT00000045448 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
84 nt
Comments
Two groups independently reported miRs derived from the same precursor. Lagos-Quintana et al. [1] reported miR-17 expressed from the 3' arm of the hairpin precursor in HeLa cells. The presence of the mature miR was confirmed by Northern blotting, abut the extents of the excised sequence are unknown. Mourelatos et al. [2] reported cloning miR-91 from the 5' arm of the same precursor. This sequence is renamed miR-17-5p here.
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-17 hsa-mir-18a hsa-mir-20a hsa-mir-93 hsa-mir-106a
mmu-mir-106a mmu-mir-106b mmu-mir-18 mmu-mir-20a mmu-mir-93
rno-mir-20a mmu-mir-17 hsa-mir-106b rno-mir-17 rno-mir-18
rno-mir-93 rno-mir-106b gga-mir-20a gga-mir-18a gga-mir-17
gga-mir-18b gga-mir-106 xla-mir-20 xla-mir-18 gga-mir-20b
hsa-mir-18b hsa-mir-20b dre-mir-17a-1 dre-mir-17a-2 dre-mir-20b
dre-mir-18a dre-mir-18b dre-mir-18c dre-mir-20a dre-mir-93
ssc-mir-106a ssc-mir-20 ssc-mir-18 ggo-mir-17 ggo-mir-18
ggo-mir-20 lca-mir-17 lca-mir-18 lca-mir-20 age-mir-17
age-mir-18 age-mir-20 ppa-mir-17 ppa-mir-18 ppa-mir-20
ppy-mir-17 ppy-mir-18 ppy-mir-20 ptr-mir-17 ptr-mir-18
ptr-mir-20 mml-mir-17 mml-mir-18 mml-mir-20 sla-mir-17
sla-mir-18 sla-mir-20 lla-mir-17 lla-mir-18 lla-mir-20
mne-mir-17 mne-mir-18 mne-mir-20 ggo-mir-106b ggo-mir-93
age-mir-106b age-mir-93 ppa-mir-106b ppa-mir-93 ppy-mir-106b
ppy-mir-93 ptr-mir-106b ptr-mir-93 mml-mir-106b mml-mir-93
sla-mir-106b sla-mir-93 lla-mir-106b lla-mir-93 mne-mir-106b
mne-mir-93 ggo-mir-106a age-mir-106a ppa-mir-106a mml-mir-106a
ppy-mir-106a ptr-mir-106a sla-mir-106a mne-mir-106a fru-mir-17-1
tni-mir-17-1 fru-mir-18 tni-mir-18 fru-mir-17-2 tni-mir-17-2
fru-mir-20 tni-mir-20 mmu-mir-20b rno-mir-20b bta-mir-18b
bta-mir-18a bta-mir-20a xtr-mir-17 xtr-mir-106 xtr-mir-18a
xtr-mir-93a xtr-mir-93b xtr-mir-20a xtr-mir-18b xtr-mir-20b
bta-mir-106 bta-mir-20b bta-mir-17 bta-mir-93 mdo-mir-17
mdo-mir-18 mdo-mir-20 mdo-mir-93
The mature miRNA of MI0000071
Mature name
hsa-miR-17-5p
Mature sequence
14| 5'- CAAAGUGCUUACAGUGCAGGUAGU -3' |37
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000377998 (targeted by hsa-miR-17-5p, predicted by TargetScan)
Chromodomain helicase-DNA-binding protein 5 (EC 3.6.1.-) (ATP- dependent helicase CHD5) (CHD-5). [Source:Uniprot/SWISSPROT;Acc:Q8TDI0]
 
     
ENST00000377565 (targeted by hsa-miR-17-5p, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
ENST00000303635 (targeted by hsa-miR-17-5p, predicted by TargetScan)
Calmodulin-binding transcription activator 1. [Source:Uniprot/SWISSPROT;Acc:Q9Y6Y1]
 
     
   
 
The mature miRNA of MI0000071
Mature name
hsa-miR-17-3p
Mature sequence
51| 5'- ACUGCAGUGAAGGCACUUGU -3' |70
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000354437 (targeted by hsa-miR-17-3p, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
ENST00000378280 (targeted by hsa-miR-17-3p, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
ENST00000378285 (targeted by hsa-miR-17-3p, predicted by TargetScan)
Tumor protein p73 (p53-like transcription factor) (p53-related protein). [Source:Uniprot/SWISSPROT;Acc:O15350]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
3. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
4. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
5. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
6. "Identification of human fetal liver miRNAs by a novel method"
  Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X
  FEBS Lett. 579:3849-3854(2005).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 837831 0937119471