keyword in microRNA or target gene :
The pre-miRNA of MI0000070
Gene
EMBL AF480551
EMBL AJ421734
HGNC MIRN16-1
Accession no
MI0000070
ID
hsa-mir-16-1
Species
Homo sapiens
Description
Homo sapiens miR-16-1 stem-loop
Genomic Location
13 : 49521110 - 49521198 : -
View in the Genome Browser
Locate on gene exon/intron/UTR
OTTHUMT00000044960 intron + 4
OTTHUMT00000044957 intron + 4
OTTHUMT00000044959 intron + 5
OTTHUMT00000044958 intron + 5
OTTHUMT00000044961 intron + 4
OTTHUMT00000044954 intron + 3
View the flanking features in the Genome Browser
Pre-miRNA length
89 nt
Comments
Human miR-16 has been cloned by independent groups [1,2]. This precursor sequence maps to chromosome 13, and was named mir-16 in [1] and mir-16-precursor-13 in [2]. Lim et al. reported 2 identical chromosome 13 loci, which appear to map to the same locus in subsequent genome assemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [3]. A second putative mir-16 hairpin precursor is located on chromosome 3 (MIR:MI0000738).
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
hsa-mir-15a hsa-mir-16-1 hsa-mir-16-2 mmu-mir-15b mmu-mir-195
hsa-mir-15b hsa-mir-195 mmu-mir-15a mmu-mir-16-1 mmu-mir-16-2
rno-mir-15b rno-mir-16 rno-mir-195 gga-mir-16-1 gga-mir-15a
gga-mir-16-2 gga-mir-15b dre-mir-15a-1 dre-mir-15a-2 dre-mir-15b
dre-mir-16a dre-mir-16b dre-mir-16c dre-mir-457a dre-mir-457b
ssc-mir-15b ggo-mir-15b age-mir-15b ppa-mir-15b ppy-mir-15b
ptr-mir-15b mml-mir-15b lla-mir-15b mne-mir-15b ggo-mir-195
ppa-mir-195 age-mir-15a age-mir-16 ggo-mir-15a ggo-mir-16
mne-mir-15a mne-mir-16 sla-mir-15a sla-mir-16 ppa-mir-15a
ppa-mir-16 lca-mir-15a lca-mir-16 mml-mir-15a mml-mir-16
ppy-mir-15a ppy-mir-16 ptr-mir-15a ptr-mir-16 lla-mir-15a
lla-mir-16 fru-mir-15b tni-mir-15b fru-mir-15a tni-mir-15a
fru-mir-16 tni-mir-16 bta-mir-16 dre-mir-15c xtr-mir-15a
xtr-mir-15b xtr-mir-16c xtr-mir-16a xtr-mir-15c xtr-mir-16b
bta-mir-15b mdo-mir-15a mdo-mir-16 bta-mir-15a bta-mir-195
The mature miRNA of MI0000070
Mature name
hsa-miR-16
Mature sequence
14| 5'- UAGCAGCACGUAAAUAUUGGCG -3' |35
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000270724 (targeted by hsa-miR-16, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378964 (targeted by hsa-miR-16, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
ENST00000378935 (targeted by hsa-miR-16, predicted by TargetScan)
Integrator complex subunit 11 (EC 3.1.27.-) (Int11) (CPSF3L-like protein) (Protein related to CPSF subunits of 68 kDa) (RC-68). [Source:Uniprot/SWISSPROT;Acc:Q5TA45]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
  Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G
  Genes Dev. 16:720-728(2002).
3. "Vertebrate microRNA genes"
  Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP
  Science. 299:1540(2003).
4. "Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia"
  Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM
  Proc Natl Acad Sci U S A. 99:15524-15529(2002).
5. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
6. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
7. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 999629 0937119471