keyword in microRNA or target gene :
The pre-miRNA of MI0000067
Gene
EMBL AJ421731
RFAM let-7
HGNC MIRNLET7F1
Accession no
MI0000067
ID
hsa-let-7f-1
Species
Homo sapiens
Description
Homo sapiens let-7f-1 stem-loop
Genomic Location
9 : 95978450 - 95978536 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
87 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-let-7 hsa-let-7a-1 hsa-let-7a-2 hsa-let-7a-3 hsa-let-7b
hsa-let-7c hsa-let-7d hsa-let-7e hsa-let-7f-1 hsa-let-7f-2
hsa-mir-98 mmu-let-7g mmu-let-7i mmu-let-7d dme-let-7
hsa-let-7g hsa-let-7i cbr-let-7 mmu-let-7a-1 mmu-let-7a-2
mmu-let-7b mmu-let-7c-1 mmu-let-7c-2 mmu-let-7e mmu-let-7f-1
mmu-let-7f-2 mmu-mir-98 rno-let-7d rno-let-7a-1 rno-let-7a-2
rno-let-7b rno-let-7c-1 rno-let-7c-2 rno-let-7e rno-let-7f-1
rno-let-7f-2 rno-let-7i rno-mir-98 gga-let-7i gga-let-7a-3
gga-let-7b gga-let-7c gga-let-7g gga-let-7d gga-let-7f
gga-let-7a-1 gga-let-7a-2 gga-let-7j gga-let-7k dps-let-7
aga-let-7 dre-let-7a-1 dre-let-7a-2 dre-let-7a-3 dre-let-7a-4
dre-let-7a-5 dre-let-7a-6 dre-let-7b dre-let-7c-1 dre-let-7c-2
dre-let-7d-1 dre-let-7d-2 dre-let-7e dre-let-7f dre-let-7g-1
dre-let-7g-2 dre-let-7h dre-let-7i ssc-let-7c ssc-let-7f
ssc-let-7i mml-mir-98 ptr-mir-98 ggo-mir-98 ppy-mir-98
age-mir-98 ppa-mir-98 fru-let-7h tni-let-7h fru-let-7e
tni-let-7e fru-let-7a-3 tni-let-7a-3 fru-let-7i tni-let-7i
fru-let-7a-2 tni-let-7a-2 fru-let-7d tni-let-7d fru-let-7j
tni-let-7j dre-let-7j fru-let-7b tni-let-7b fru-let-7a-1
tni-let-7a-1 fru-let-7g tni-let-7g bta-let-7f-2 xtr-let-7b
xtr-mir-98 xtr-let-7c xtr-let-7f xtr-let-7g xtr-let-7i
xtr-let-7e-1 xtr-let-7a xtr-let-7e-2 bmo-let-7 bta-mir-98
bta-let-7d bta-let-7g bta-let-7a-1 bta-let-7f-1 bta-let-7i
mdo-let-7a-2 mdo-let-7g mdo-let-7i mdo-let-7f-2 mdo-let-7a-3
mdo-let-7b mdo-let-7a-1 mdo-let-7f-1 mdo-let-7d bta-let-7a-2
bta-let-7a-3 bta-let-7b bta-let-7c bta-let-7e ame-let-7
The mature miRNA of MI0000067
Mature name
hsa-let-7f
Mature sequence
7| 5'- UGAGGUAGUAGAUUGUAUAGUU -3' |28
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000311066 (targeted by hsa-let-7f, predicted by TargetScan)
PR domain zinc finger protein 2 (PR domain-containing protein 2) (Retinoblastoma protein-interacting zinc-finger protein) (Zinc finger protein RIZ) (MTE-binding protein) (MTB-ZF) (GATA-3-binding protein G3B). [Source:Uniprot/SWISSPROT;Acc:Q13029]
 
     
ENST00000343137 (targeted by hsa-let-7f, predicted by TargetScan)
PR domain zinc finger protein 2 (PR domain-containing protein 2) (Retinoblastoma protein-interacting zinc-finger protein) (Zinc finger protein RIZ) (MTE-binding protein) (MTB-ZF) (GATA-3-binding protein G3B). [Source:Uniprot/SWISSPROT;Acc:Q13029]
 
     
ENST00000374673 (targeted by hsa-let-7f, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
3. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 500498 0937119471