keyword in microRNA or target gene :
The pre-miRNA of MI0000060
Gene
EMBL AJ421724
RFAM let-7
HGNC MIRNLET7A1
Accession no
MI0000060
ID
hsa-let-7a-1
Species
Homo sapiens
Description
Homo sapiens let-7a-1 stem-loop
Genomic Location
9 : 95978060 - 95978139 : +
View in the Genome Browser
Locate on gene exon/intron/UTR
intergenic
Pre-miRNA length
80 nt
Comments
2nd structure
[ pdf format ]
Get miRNA's sequence:
 
Related miRNAs
cel-let-7 hsa-let-7a-1 hsa-let-7a-2 hsa-let-7a-3 hsa-let-7b
hsa-let-7c hsa-let-7d hsa-let-7e hsa-let-7f-1 hsa-let-7f-2
hsa-mir-98 mmu-let-7g mmu-let-7i mmu-let-7d dme-let-7
hsa-let-7g hsa-let-7i cbr-let-7 mmu-let-7a-1 mmu-let-7a-2
mmu-let-7b mmu-let-7c-1 mmu-let-7c-2 mmu-let-7e mmu-let-7f-1
mmu-let-7f-2 mmu-mir-98 rno-let-7d rno-let-7a-1 rno-let-7a-2
rno-let-7b rno-let-7c-1 rno-let-7c-2 rno-let-7e rno-let-7f-1
rno-let-7f-2 rno-let-7i rno-mir-98 gga-let-7i gga-let-7a-3
gga-let-7b gga-let-7c gga-let-7g gga-let-7d gga-let-7f
gga-let-7a-1 gga-let-7a-2 gga-let-7j gga-let-7k dps-let-7
aga-let-7 dre-let-7a-1 dre-let-7a-2 dre-let-7a-3 dre-let-7a-4
dre-let-7a-5 dre-let-7a-6 dre-let-7b dre-let-7c-1 dre-let-7c-2
dre-let-7d-1 dre-let-7d-2 dre-let-7e dre-let-7f dre-let-7g-1
dre-let-7g-2 dre-let-7h dre-let-7i ssc-let-7c ssc-let-7f
ssc-let-7i mml-mir-98 ptr-mir-98 ggo-mir-98 ppy-mir-98
age-mir-98 ppa-mir-98 fru-let-7h tni-let-7h fru-let-7e
tni-let-7e fru-let-7a-3 tni-let-7a-3 fru-let-7i tni-let-7i
fru-let-7a-2 tni-let-7a-2 fru-let-7d tni-let-7d fru-let-7j
tni-let-7j dre-let-7j fru-let-7b tni-let-7b fru-let-7a-1
tni-let-7a-1 fru-let-7g tni-let-7g bta-let-7f-2 xtr-let-7b
xtr-mir-98 xtr-let-7c xtr-let-7f xtr-let-7g xtr-let-7i
xtr-let-7e-1 xtr-let-7a xtr-let-7e-2 bmo-let-7 bta-mir-98
bta-let-7d bta-let-7g bta-let-7a-1 bta-let-7f-1 bta-let-7i
mdo-let-7a-2 mdo-let-7g mdo-let-7i mdo-let-7f-2 mdo-let-7a-3
mdo-let-7b mdo-let-7a-1 mdo-let-7f-1 mdo-let-7d bta-let-7a-2
bta-let-7a-3 bta-let-7b bta-let-7c bta-let-7e ame-let-7
The mature miRNA of MI0000060
Mature name
hsa-let-7a
Mature sequence
6| 5'- UGAGGUAGUAGGUUGUAUAGUU -3' |27
Tissue specificity
Bead-array microRNA expression profile
MicroRNA Expression Profiles Classify Human Cancers
  Nature 435, 834-838(9 June 2005)

QPCR microRNA expression profile

 

Target genes
ENST00000374673 (targeted by hsa-let-7a, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
ENST00000374673 (targeted by hsa-let-7a, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
ENST00000311538 (targeted by hsa-let-7a, predicted by TargetScan)
Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC). [Source:Uniprot/SWISSPROT;Acc:P98160]
 
     
   
 
The reference
Literature
1. "Identification of novel genes coding for small expressed RNAs"
  Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T
  Science. 294:853-858(2001).
2. "Human embryonic stem cells express a unique set of microRNAs"
  Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
  Dev Biol. 270:488-498(2004).
3. "Numerous microRNPs in neuronal cells containing novel microRNAs"
  Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G
  RNA. 9:180-186(2003).
4. "Reduced accumulation of specific microRNAs in colorectal neoplasia"
  Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ
  Mol Cancer Res. 1:882-891(2003).
5. "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
  Kasashima K, Nakamura Y, Kozu T
  Biochem Biophys Res Commun. 322:403-410(2004).
 

Department of Biological Science and Technology,
Institute of Bioinformatics National Chiao Tung University, Hsinchu, Taiwan
Contact with: bryan@mail.NCTU.edu.tw

Get Access to [CBST, http://www.life.nctu.edu.tw// CBST, http://life.nctu.edu.tw/ /IBSB, http://bioinfo.nctu.edu.tw/ /BST, http://bio.life.nctu.edu.tw/ /IMMBE, http://bioce.life.nctu.edu.tw] CBST, http://www.life.nctu.edu.tw/ IBSB, http://bioinfo.nctu.edu.tw/ BST, http://bio.life.nctu.edu.tw/ IMMBE, http://bioce.life.nctu.edu.tw 370339 0937119471